miRBase entry: hsa-mir-301b

Stem-loop hsa-mir-301b


Accession
MI0005568
Symbol
HGNC: MIR301B
Description
Homo sapiens hsa-mir-301b precursor miRNA
Gene family
MIPF0000034; mir-130

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR301B is a microRNA that has been studied in relation to its expression levels [PMC8109121]. In a study, the expressions of miR-454, miR301a, MIR301B, miR130a, and miR130b were normalized to U6 using the 2-ΔΔCt method [PMC8109121]. This method is commonly used to analyze gene expression levels. The study aimed to investigate the impact of BHLHE40/41 on the expression of MIR130B and MIR301B [PMC6659797]. BHLHE40/41 is a transcription factor that has been associated with various biological processes and diseases [PMC6659797]. By studying its influence on MIR130B and MIR301B expression, researchers aimed to gain insights into the regulatory mechanisms involved in microRNA expression [PMC6659797]. The findings of this study could potentially contribute to a better understanding of the roles played by microRNAs in cellular processes and disease development [PMC6659797]. Further research may be needed to fully elucidate the specific mechanisms by which BHLHE40/41 influences MIR130B and MIR301B expression [PMC6659797].

Literature search
62 open access papers mention hsa-mir-301b
(167 sentences)

Sequence

38694 reads, 581 reads per million, 84 experiments
gccgcagguGCUCUGACGAGGUUGCACUACUgugcucugagaagCAGUGCAAUGAUAUUGUCAAAGCaucugggacca
.((.((((((((.((((((.((((((((.((...........)).))))))))....)))))).))))))))))....

Structure
---g  g        C      ---G        A  gugc 
    cc cagguGCU UGACGA    GUUGCACU CU    u
    || |||||||| ||||||    |||||||| ||    c
    gg gucuaCGA ACUGUU    UAACGUGA ga    u
acca  -        A      AUAG        C  agag 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr22: 21652981-21653058 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-301b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-301b-3p

Accession MIMAT0004958
Description Homo sapiens hsa-miR-301b-3p mature miRNA
Sequence 45 - CAGUGCAAUGAUAUUGUCAAAGC - 67
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-301b-5p

Accession MIMAT0032026
Description Homo sapiens hsa-miR-301b-5p mature miRNA
Sequence 10 - GCUCUGACGAGGUUGCACUACU - 31
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298