MIR873 is a microRNA molecule that plays a role in various biological processes, including cancer development and drug resistance [PMC7589921]. It has been found to be upregulated in thyroid cancer, suggesting its involvement in the disease [PMC4621222]. Additionally, MIR873 has been identified as a potential biomarker for the diagnosis of different cancers, such as lung cancer and breast cancer [PMC4621222]. In the context of musculoskeletal disease, MIR873 has been associated with bone geometry and muscle metabolism [PMC3210160]. It is located within a genomic region that also contains the MIR876 gene, and both genes have been strongly associated with bone geometry and muscle mass in Chinese populations [PMC3210160]. However, these associations were not replicated in Caucasians [PMC3210160]. MIR873 has also been implicated in neural diseases based on its target genes associated with such diseases [PMC7708977]. In pregnancy-related conditions, circulating levels of MIR873 have been found to be negatively associated with insulin sensitivity [PMC8900031]. Overall, these findings highlight the diverse roles of MIR873 in various biological processes and its potential as a diagnostic biomarker for different diseases.
-- u ca G A G a ga gug g uuu C GGAACUUGU AGUCUCCU uu a ||| | ||| | ||||||||| |||||||| || a cac c aAG G CCUUGAGUA UCAGAGGa aa a aa c ac G C G c gu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004953 |
Description | Homo sapiens hsa-miR-873-5p mature miRNA |
Sequence | 11 - GCAGGAACUUGUGAGUCUCCU - 31 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0022717 |
Description | Homo sapiens hsa-miR-873-3p mature miRNA |
Sequence | 46 - GGAGACUGAUGAGUUCCCGGGA - 67 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|