miRBase entry: hsa-mir-873

Stem-loop hsa-mir-873


Accession
MI0005564
Symbol
HGNC: MIR873
Description
Homo sapiens hsa-mir-873 precursor miRNA
Gene family
MIPF0000390; mir-873

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR873 is a microRNA molecule that plays a role in various biological processes, including cancer development and drug resistance [PMC7589921]. It has been found to be upregulated in thyroid cancer, suggesting its involvement in the disease [PMC4621222]. Additionally, MIR873 has been identified as a potential biomarker for the diagnosis of different cancers, such as lung cancer and breast cancer [PMC4621222]. In the context of musculoskeletal disease, MIR873 has been associated with bone geometry and muscle metabolism [PMC3210160]. It is located within a genomic region that also contains the MIR876 gene, and both genes have been strongly associated with bone geometry and muscle mass in Chinese populations [PMC3210160]. However, these associations were not replicated in Caucasians [PMC3210160]. MIR873 has also been implicated in neural diseases based on its target genes associated with such diseases [PMC7708977]. In pregnancy-related conditions, circulating levels of MIR873 have been found to be negatively associated with insulin sensitivity [PMC8900031]. Overall, these findings highlight the diverse roles of MIR873 in various biological processes and its potential as a diagnostic biomarker for different diseases.

Literature search
19 open access papers mention hsa-mir-873
(34 sentences)

Sequence

4221 reads, 152 reads per million, 76 experiments
gugugcauuuGCAGGAACUUGUGAGUCUCCUauugaaaaugaacaGGAGACUGAUGAGUUCCCGGGAacacccacaa
(((.(..(((.(.(((((((((.((((((((.((.......)).)))))))).))))))))).).)))..).)))..

Structure
--   u ca   G A         G        a  ga 
  gug g  uuu C GGAACUUGU AGUCUCCU uu  a
  ||| |  ||| | ||||||||| |||||||| ||  a
  cac c  aAG G CCUUGAGUA UCAGAGGa aa  a
aa   c ac   G C         G        c  gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr9: 28888879-28888955 [-]

Disease association
hsa-mir-873 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-873-5p

Accession MIMAT0004953
Description Homo sapiens hsa-miR-873-5p mature miRNA
Sequence 11 - GCAGGAACUUGUGAGUCUCCU - 31
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-873-3p

Accession MIMAT0022717
Description Homo sapiens hsa-miR-873-3p mature miRNA
Sequence 46 - GGAGACUGAUGAGUUCCCGGGA - 67
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298