![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-873 |
|||||
Accession | MI0005564 (change log) | ||||
Symbol | HGNC:MIR873 | ||||
Description | Homo sapiens miR-873 stem-loop | ||||
Gene family | MIPF0000390; mir-873 | ||||
Literature search |
![]()
19 open access papers mention hsa-mir-873 | ||||
Stem-loop |
-- u ca g a ug g a ga 5' gug g uuu c ggaacu u agucuccu uu a ||| | ||| | |||||| | |||||||| || a 3' cac c aag g ccuuga a ucagagga aa a aa c ac g c gu g c gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-873-5p |
|
Accession | MIMAT0004953 |
Previous IDs | hsa-miR-873 |
Sequence |
11 - gcaggaacuugugagucuccu - 31 |
Deep sequencing | 4944 reads, 121 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-873-3p |
|
Accession | MIMAT0022717 |
Sequence |
46 - ggagacugaugaguucccggga - 67 |
Deep sequencing | 1065 reads, 55 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|