miRBase entry: mmu-mir-653

Stem-loop mmu-mir-653


Accession
MI0005557
Symbol
MGI: Mir653
Description
Mus musculus mmu-mir-653 precursor miRNA
Gene family
MIPF0000435; mir-653

Literature search
2 open access papers mention mmu-mir-653
(2 sentences)

Sequence

655 reads, 20 reads per million, 32 experiments
cauucuuucaGUGUUGAAACAAUCUCUACUGaaccaagcuccaaagcgagUUCACUGGAGUUUGUUUCAGUauugcaggagugcu
(((((((.((((((((((((((.(((((.(((((...(((....)))..))))).))))).)))))))))))))).)))))))..

Structure
--       u              U     C     caa   c 
  cauucuu caGUGUUGAAACAA CUCUA UGaac   gcu c
  ||||||| |||||||||||||| ||||| |||||   |||  
  gugagga guuaUGACUUUGUU GAGGU ACUUg   cga a
uc       c              U     C     -ag   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
chr6: 3721301-3721385 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-653
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-653-5p

Accession MIMAT0004943
Description Mus musculus mmu-miR-653-5p mature miRNA
Sequence 11 - GUGUUGAAACAAUCUCUACUG - 31
Evidence experimental
RAKE [1], 454 [3], Illumina [4]
Database links
Predicted targets

Mature mmu-miR-653-3p

Accession MIMAT0017284
Description Mus musculus mmu-miR-653-3p mature miRNA
Sequence 51 - UUCACUGGAGUUUGUUUCAGU - 71
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  3. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  4. PubMed ID: 17989215
    RNA sequence analysis defines Dicer's role in mouse embryonic stem cells
    "Calabrese JM, Seila AC, Yeo GW, Sharp PA"
    "Proc Natl Acad Sci U S A (2007) 104:18097-18102