Stem-loop mmu-mir-873a

Accession

MI0005550

Symbol

MGI: Mir873a

Description

Mus musculus mmu-mir-873a precursor miRNA

Gene family

MIPF0000390; mir-873

Literature search

7 open access papers mention mmu-mir-873a
(39 sentences)

Sequence

5043 reads, 93 reads per million, 41 experiments

gugugcauuuGCAGGAACUUGUGAGUCUCCUauugaaaauagacagGAGACUGACAAGUUCCCGGGAacacccacaa
(((.(..(((.(.(((((((((.((((((((.((.......)).)))))))).))))))))).).)))..).)))..

Structure

--   u ca   G A         G        a  ga 
  gug g  uuu C GGAACUUGU AGUCUCCU uu  a
  ||| |  ||| | ||||||||| |||||||| ||  a
  cac c  aAG G CCUUGAACA UCAGAGga ag  a
aa   c ac   G C         G        c  au 

Annotation confidence High

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr4: 36668510-36668586 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-873a

Mature mmu-miR-873a-5p

• Accession: MIMAT0004936
• Description: Mus musculus mmu-miR-873a-5p mature miRNA
• Sequence: 11 - GCAGGAACUUGUGAGUCUCCU - 31
• Evidence: experimental ; cloned [2], Illumina [3-4]

Mature mmu-miR-873a-3p

• Accession: MIMAT0017279
• Description: Mus musculus mmu-miR-873a-3p mature miRNA
• Sequence: 47 - GAGACUGACAAGUUCCCGGGA - 67
• Evidence: experimental ; Illumina [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298