![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-872 |
|||||
Accession | MI0005549 (change log) | ||||
Symbol | MGI:Mir872 | ||||
Description | Mus musculus miR-872 stem-loop | ||||
Gene family | MIPF0000399; mir-872 | ||||
Literature search |
![]()
4 open access papers mention mmu-mir-872 | ||||
Stem-loop |
-- u a u -- accucau 5' aacu guuag agguuacu gu uaguucagg u |||| ||||| |||||||| || ||||||||| 3' uugg caauc uccgauga cg aucaagucc a ua u c - uu gucuuuc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-872-5p |
|
Accession | MIMAT0004934 |
Previous IDs | mmu-miR-872 |
Sequence |
11 - aagguuacuuguuaguucagg - 31 |
Deep sequencing | 197062 reads, 103 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-872-3p |
|
Accession | MIMAT0004935 |
Previous IDs | mmu-miR-872* |
Sequence |
50 - ugaacuauugcaguagccuccu - 71 |
Deep sequencing | 33970 reads, 104 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|