Stem-loop sequence mmu-mir-872

AccessionMI0005549 (change log)
Symbol MGI:Mir872
DescriptionMus musculus miR-872 stem-loop
Gene family MIPF0000399; mir-872
Literature search

4 open access papers mention mmu-mir-872
(13 sentences)

Stem-loop
   --    u     a        u  --         accucau 
5'   aacu guuag agguuacu gu  uaguucagg       u
     |||| ||||| |||||||| ||  |||||||||        
3'   uugg caauc uccgauga cg  aucaagucc       a
   ua    u     c        -  uu         gucuuuc 
Get sequence
Deep sequencing
231039 reads, 633 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 94665157-94665237 [+]
sense
OTTMUST00000017883 ; Ift74-001; intron 13
ENSMUST00000030311 ; Ift74-001; intron 13
Database links

Mature sequence mmu-miR-872-5p

Accession MIMAT0004934
Previous IDsmmu-miR-872
Sequence

11 - 

aagguuacuuguuaguucagg

 - 31

Get sequence
Deep sequencing197062 reads, 103 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-872-3p

Accession MIMAT0004935
Previous IDsmmu-miR-872*
Sequence

50 - 

ugaacuauugcaguagccuccu

 - 71

Get sequence
Deep sequencing33970 reads, 104 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).