![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-878 |
||||||||||||||||
Accession | MI0005548 (change log) | |||||||||||||||
Symbol | MGI:Mir878 | |||||||||||||||
Description | Mus musculus miR-878 stem-loop | |||||||||||||||
Gene family | MIPF0000434; mir-878 | |||||||||||||||
Literature search |
3 open access papers mention mmu-mir-878 | |||||||||||||||
Stem-loop |
--u aa g - a a a guga 5' gc u cuuuaucuagu ugg uguca g cac a || | ||||||||||| ||| ||||| | ||| a 3' cg a gagauggguca acc acagu c gug c acu gg g c - a - aauu |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
|||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
|
Mature sequence mmu-miR-878-5p |
|
Accession | MIMAT0004932 |
Sequence |
11 - uaucuaguuggaugucaagaca - 32 |
Deep sequencing | 84680 reads, 39 experiments |
Evidence | experimental; cloned [2], 454 [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-878-3p |
|
Accession | MIMAT0004933 |
Sequence |
47 - gcaugacaccacacuggguaga - 68 |
Deep sequencing | 18980 reads, 44 experiments |
Evidence | experimental; cloned [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17989215
"RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
Proc Natl Acad Sci U S A. 104:18097-18102(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|