Stem-loop mmu-mir-466h

Accession

MI0005511

Symbol

MGI: Mir466h

Description

Mus musculus mmu-mir-466h precursor miRNA

Gene family

MIPF0000316; mir-467

Literature search

26 open access papers mention mmu-mir-466h
(63 sentences)

Sequence

2509 reads, 128 reads per million, 89 experiments

uguauauuugUGUGUGCAUGUGCUUGUGUGUAugugaauauauauaucaUACGCACGCACACACACACacaaaugcaagca
(((.((((((((((((..(((((..(((((((((.............))))))))))))))..))))))))))))...)))

Structure

   --a            CA     UU         ugaau 
ugu   uauuugUGUGUG  UGUGC  GUGUGUAug     a
|||   ||||||||||||  |||||  |||||||||     u
acg   guaaacaCACAC  ACACG  CACGCAUac     a
   aac            AC     --         uauau 

Annotation confidence Not enough data

Genome context

chr2: 10514891-10514971 [+]

Clustered miRNAs

19 other miRNAs are < 10 kb from mmu-mir-466h

Mature mmu-miR-466h-5p

• Accession: MIMAT0004884
• Description: Mus musculus mmu-miR-466h-5p mature miRNA
• Sequence: 11 - UGUGUGCAUGUGCUUGUGUGUA - 32
• Evidence: experimental ; cloned [1], 454 [2], Illumina [4]

Mature mmu-miR-466h-3p

• Accession: MIMAT0017274
• Description: Mus musculus mmu-miR-466h-3p mature miRNA
• Sequence: 50 - UACGCACGCACACACACAC - 68
• Evidence: experimental ; 454 [3], Illumina [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


3. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


4. PubMed ID: 17989215
   RNA sequence analysis defines Dicer's role in mouse embryonic stem cells
   "Calabrese JM, Seila AC, Yeo GW, Sharp PA"
   "Proc Natl Acad Sci U S A (2007) 104:18097-18102