Stem-loop sequence mmu-mir-881

AccessionMI0005474 (change log)
Symbol MGI:Mir881
DescriptionMus musculus miR-881 stem-loop
Gene family MIPF0000429; mir-881
Literature search

3 open access papers mention mmu-mir-881
(4 sentences)

Stem-loop
   --u   g   aa          -    a    c  aucuu 
5'    gca uac  uauucagaga gaua cagu ac     u
      ||| |||  |||||||||| |||| |||| ||      
3'    ugu aug  auaagucuuu cugu guca ug     u
   acu   a   ag          u    -    a  aaauc 
Get sequence
Deep sequencing
138767 reads, 2.79e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66801944-66802021 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-881
mmu-mir-871chrX: 66810428-66810504 [-]
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
mmu-mir-463chrX: 66799223-66799297 [-]
mmu-mir-741chrX: 66796805-66796875 [-]
mmu-mir-471chrX: 66792595-66792661 [-]
Database links

Mature sequence mmu-miR-881-5p

Accession MIMAT0004845
Previous IDsmmu-miR-881*
Sequence

15 - 

cagagagauaacagucacaucu

 - 36

Get sequence
Deep sequencing3421 reads, 25 experiments
Evidence experimental; cloned [1], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-881-3p

Accession MIMAT0004846
Previous IDsmmu-miR-881
Sequence

47 - 

aacugugucuuuucugaauaga

 - 68

Get sequence
Deep sequencing135346 reads, 46 experiments
Evidence experimental; cloned [1], 454 [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).