Stem-loop sequence mmu-mir-743b

AccessionMI0005470 (change log)
Symbol MGI:Mir743b
DescriptionMus musculus miR-743b stem-loop
Gene family MIPF0000386; mir-743
Literature search

7 open access papers mention mmu-mir-743b
(9 sentences)

Stem-loop
   --u  ag    g       ac       ca     uga 
5'    gc  ugcu uguucag  ugguguc  ucaug   a
      ||  |||| |||||||  |||||||  |||||   a
3'    cg  auga auaaguc  acuacag  agugu   u
   acc  ga    g       gu       aa     uua 
Get sequence
Deep sequencing
59009 reads, 2.04e+03 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66777256-66777332 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-743b
mmu-mir-883achrX: 66780758-66780833 [-]
mmu-mir-742chrX: 66780373-66780437 [-]
mmu-mir-743bchrX: 66777256-66777332 [-]
mmu-mir-743achrX: 66776757-66776818 [-]
Database links

Mature sequence mmu-miR-743b-5p

Accession MIMAT0004839
Sequence

11 - 

uguucagacugguguccauca

 - 31

Get sequence
Deep sequencing1852 reads, 28 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-743b-3p

Accession MIMAT0004840
Sequence

46 - 

gaaagacaucaugcugaauaga

 - 67

Get sequence
Deep sequencing57157 reads, 56 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).