Stem-loop sequence bta-mir-365-1

Accession

MI0005465 (change log)

Previous IDs

bta-mir-365

Description

Bos taurus miR-365 stem-loop

Gene family

MIPF0000061; mir-365

Literature search

6 open access papers mention bta-mir-365-1
(15 sentences)

Stem-loop

   acc      aa        ac           ----   -   uuu 
5'    gcaggg  aaugaggg  uuuugggggca    gau gug   g
      ||||||  ||||||||  |||||||||||    ||| |||   c
3'    cguucu  uuauuccu  aaaauccccgu    cua cac   a
   --a      cg        -a           aaua   u   cuu 

Deep sequencing

6810 reads, 29.9 reads per million, 67 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

High-throughput sequencing suggests that the dominant miRNA arises from the 5' arm of this precursor [3], in contrast to earlier studies.

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr25: 13401780-13401866 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-365-1

• bta-mir-193b: chr25: 13397029-13397111 [+]
• bta-mir-365-1: chr25: 13401780-13401866 [+]

Database links

• EntrezGene:MIR365
• RNAcentral:URS000075AC25_9913
• miRBase Tracker:MI0005465

Mature sequence bta-miR-365-5p

• Accession: MIMAT0012539
• Sequence: 16 - agggacuuuugggggcagaugug - 38
• Deep sequencing: 1375 reads, 33 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:bta-miR-365-5p

Mature sequence bta-miR-365-3p

• Accession: MIMAT0004341
• Previous IDs: bta-miR-365
• Sequence: 56 - uaaugccccuaaaaauccuuau - 77
• Deep sequencing: 10870 reads, 67 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • TargetScanVert:bta-miR-365-3p

References

1. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
2. PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3. PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).