![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-195 |
||||||
Accession | MI0005459 (change log) | |||||
Description | Bos taurus miR-195 stem-loop | |||||
Gene family | MIPF0000006; mir-15 | |||||
Literature search |
3 open access papers mention bta-mir-195 | |||||
Stem-loop |
a uc g cu -a cu gaa 5' gc cccug cu agcagcacag aauauuggca gg g || ||||| || |||||||||| |||||||||| || 3' ug gggac ga ucgucguguc uuauaaccgu cc a g gu g cc gg -- gaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence bta-miR-195 |
|
Accession | MIMAT0004335 |
Sequence |
15 - uagcagcacagaaauauuggca - 36 |
Deep sequencing | 25445 reads, 66 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|