![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-let-7e |
||||||||
Accession | MI0005455 (change log) | |||||||
Description | Bos taurus let-7e stem-loop | |||||||
Gene family | MIPF0000002; let-7 | |||||||
Literature search |
![]()
52 open access papers mention bta-let-7e | |||||||
Stem-loop |
c cu g u ----gga a 5' cc ggg gag uaggagguuguauagu ga gg c || ||| ||| |||||||||||||||| || || 3' gg ccc uuc auccuccggcauauca cu cc a a cu g - agaggaa c |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bta-let-7e |
|
Accession | MIMAT0004333 |
Sequence |
8 - ugagguaggagguuguauagu - 28 |
Deep sequencing | 2744920 reads, 78 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|