![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR870 |
|||||
Accession | MI0005448 (change log) | ||||
Description | Arabidopsis thaliana miR870 stem-loop | ||||
Literature search |
2 open access papers mention ath-MIR870 | ||||
Stem-loop |
- a a ac a 5' gaucgaagaa caucaaauuaga ugug ugcaaa uuag c |||||||||| |||||||||||| |||| |||||| |||| 3' cuagcuucuu gugguuuaaucu acac acguuu aauc u u a a ac c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR870-5p |
|
Accession | MIMAT0032025 |
Sequence |
6 - aagaacaucaaauuagaaugu - 26 |
Evidence | experimental; Illumina [2] |
Mature sequence ath-miR870-3p |
|
Accession | MIMAT0004322 |
Previous IDs | ath-miR870 |
Sequence |
65 - uaauuugguguuucuucgauc - 85 |
Evidence | experimental; 454 [1], cloned [1] |
References |
|
1 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
2 |
PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"
BMC Genomics. 14:701(2013).
|