Stem-loop sequence ath-MIR867

AccessionMI0005445 (change log)
DescriptionArabidopsis thaliana miR867 stem-loop
Literature search

1 open access papers mention ath-MIR867
(2 sentences)

Stem-loop 
      -c           a      c        g  u   u         -   ---   a 
5' aca  auaaaacuagu uauugc uugaacau gu uau aggaaagac aug   aga c
   |||  ||||||||||| |||||| |||||||| || ||| ||||||||| |||   ||| a
3' ugu  uauuuugauua guaaug aacuugua ca aua uccuuuuug uac   ucu u
      uu           a      a        a  u   u         a   aag   a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 11375364-11375481 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR867
ath-MIR4239chr4: 11368752-11368874 [+]
ath-MIR1887chr4: 11370263-11370325 [+]
ath-MIR867chr4: 11375364-11375481 [+]
Database links

Mature sequence ath-miR867

Accession MIMAT0004318
Sequence

24 -  

uugaacaugguuuauuaggaa

 - 44

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).