![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR865 |
|||||
Accession | MI0005442 (change log) | ||||
Description | Arabidopsis thaliana miR865 stem-loop | ||||
Literature search |
1 open access papers mention ath-MIR865 | ||||
Stem-loop |
c a cu a c au uuuu cu uuca uccuu 5' gau ugggauga uuuggau a uugag aaaaa ugug uucaau auugaau ca a ||| |||||||| ||||||| | ||||| ||||| |||| |||||| ||||||| || 3' cua acccuacu aaaccua u aacuc uuuuu acgc aaguua uaacuua gu a a a uu a c au -uuu uc -uac uccca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR865-5p |
|
Accession | MIMAT0004313 |
Sequence |
9 - augaauuuggaucuaauugag - 29 |
Evidence | experimental; cloned [1], Illumina [2] |
Mature sequence ath-miR865-3p |
|
Accession | MIMAT0004314 |
Sequence |
108 - uuuuuccucaaauuuauccaa - 128 |
Evidence | experimental; cloned [1] |
References |
|
1 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
2 |
PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"
BMC Genomics. 14:701(2013).
|