Stem-loop sequence ath-MIR865

AccessionMI0005442 (change log)
DescriptionArabidopsis thaliana miR865 stem-loop
Literature search

1 open access papers mention ath-MIR865
(1 sentences)

Stem-loop 
      c        a       cu a     c     au    uuuu      cu       uuca  uccuu 
5' gau ugggauga uuuggau  a uugag aaaaa  ugug    uucaau  auugaau    ca     a
   ||| |||||||| |||||||  | ||||| |||||  ||||    ||||||  |||||||    ||      
3' cua acccuacu aaaccua  u aacuc uuuuu  acgc    aaguua  uaacuua    gu     a
      a        a       uu a     c     au    -uuu      uc       -uac  uccca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 5169990-5170131 [+]
intergenic
Database links

Mature sequence ath-miR865-5p

Accession MIMAT0004313
Sequence

9 -  

augaauuuggaucuaauugag

 - 29

Get sequence
Evidence experimental; cloned [1], Illumina [2]

Mature sequence ath-miR865-3p

Accession MIMAT0004314
Sequence

108 -  

uuuuuccucaaauuuauccaa

 - 128

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).