![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR858a |
||||||
Accession | MI0005435 (change log) | |||||
Previous IDs | ath-MIR858 | |||||
Description | Arabidopsis thaliana miR858 stem-loop | |||||
Gene family | MIPF0001138; MIR858 | |||||
Literature search |
![]()
5 open access papers mention ath-MIR858a | |||||
Stem-loop |
---- -uuu - cg ug g ucuccuca cuaauacgcgcuuuaucguuuauuucauucauccauc 5' cuca uc guuucg uugucuguu accu gucuc auc aaacc c |||| || |||||| ||||||||| |||| ||||| ||| ||||| 3' gagu ag caaagc agcagauag uggg uaggg uag uuugg u cuuu uuuu u -a gu g --uuauug cuauuugguacaugcaaucaaauacuacuaguauucu |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ath-miR858a |
|
Accession | MIMAT0004302 |
Previous IDs | ath-miR858 |
Sequence |
11 - uuucguugucuguucgaccuu - 31 |
Evidence | experimental; 454 [1], cloned [1] |
References |
|
1 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|