Stem-loop sequence ath-MIR847

AccessionMI0005410 (change log)
DescriptionArabidopsis thaliana miR847 stem-loop
Gene family MIPF0001171; MIR847
Literature search

1 open access papers mention ath-MIR847
(1 sentences)

Stem-loop
   cauuuucuuguauucaaaguaucuuaaguuaagaaga      --            uu  u        a  gg a     aaucuaaac       g  gc     ---     u 
5'                                      gaauaa  gauucuuacauc  ga gaagagga ug  a gccga         ugaaaca ag  gucac   ccaau a
                                        ||||||  ||||||||||||  || |||||||| ||  | |||||         ||||||| ||  |||||   ||||| u
3'                                      cuuauu  uuaagaauguag  cu cuucuccu ac  u cggcu         gcuuugu uc  uagug   gguua c
   --uauagauugucuaaaaagugagguagauuacacag      gu            uu  u        c  uu c     cuaugucua       a  ua     aau     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 2165517-2165746 [+]
intergenic
Database links

Mature sequence ath-miR847

Accession MIMAT0004278
Sequence

159 - 

ucacuccucuucuucuugaug

 - 179

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).