Stem-loop sequence ath-MIR844

AccessionMI0005400 (change log)
DescriptionArabidopsis thaliana miR844 stem-loop
Gene family MIPF0001197; MIR844
Literature search

2 open access papers mention ath-MIR844
(3 sentences)

Stem-loop 
   -------ggaagga    uuu     ug    aau  aucuuuu                a         u           g   cuug    u   u 
5'               gaug   gcagu  guuu   ga       acauugaagagaagga ugguaagau gcuuauaagcu gau    aggg gag g
                 ||||   |||||  ||||   ||       |||||||||||||||| ||||||||| ||||||||||| |||    |||| |||  
3'               cuau   cgucg  cagg   cu       uguaacuuuucuucuu aucauucua cgaauauucgg uua    ucuu cuc g
   uguuuacuagugga    uuu     --    aau  -----gu                g         c           g   cgca    -   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR844 was first identified by Rajapopalan et al [1], with two mature products names miR844-5p and miR844-3p. Fahlgren et al identify a cleavage product for the 5' mature sequence, which is therefore assumed to be the dominant mature miRNA [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 9942151-9942335 [-]
intergenic
Database links

Mature sequence ath-miR844-5p

Accession MIMAT0004266
Previous IDsath-miR844
Sequence

55 -  

ugguaagauugcuuauaagcu

 - 75

Get sequence
Evidence experimental; 454 [1-2], cloned [2]

Mature sequence ath-miR844-3p

Accession MIMAT0004267
Previous IDsath-miR844*
Sequence

114 -  

uuauaagccaucuuacuaguu

 - 134

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).