Stem-loop sequence ath-MIR836

AccessionMI0005392 (change log)
DescriptionArabidopsis thaliana miR836 stem-loop
Literature search

1 open access papers mention ath-MIR836
(1 sentences)

Stem-loop
   g          a   --ua         a            g    c          c               ua     g uaua          -  gg  a    uu     c            c  ua                    ccuucaacaaaaauaccccccucuu       
5'  caaagcugcc uuu    uaguccaaa cuuaaauuucgu uuug aagucuccac caucgaaggaaacac  gaaga a    auuuauuuga gg  ag aaua  ugaca ggaagcauagcu ca  uccuucaauggagguguggu                         gaaacu 
    |||||||||| |||    ||||||||| |||||||||||| |||| |||||||||| |||||||||||||||  ||||| |    |||||||||| ||  || ||||  ||||| |||||||||||| ||  ||||||||||||||||||||                         ||||| c
3'  guuuugacgg aaa    aucggguuu gaauuuaaagca aaau uucagaggug guaguuuccuuugug  cuuuu u    uaaauaaacu cc  uc uuau  acugu ccuucguaucga gu  aggaaguuaccuccacacca                         cuuugu 
   -          c   uaaa         -            a    u          c               uc     g cucg          a  au  c    --     u            a  cc                    -------------------------       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 10634280-10634616 [-]
intergenic
Database links

Mature sequence ath-miR836

Accession MIMAT0004257
Sequence

263 - 

uccuguguuuccuuugaugcgugg

 - 286

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).