![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR827 |
|||||
Accession | MI0005383 (change log) | ||||
Description | Arabidopsis thaliana miR827 stem-loop | ||||
Gene family | MIPF0001113; MIR827_3 | ||||
Literature search |
![]()
9 open access papers mention ath-MIR827 | ||||
Stem-loop |
uuccaugaaacguuauagguuuuuuucuuucucucu -c u u u u a c au ucc 5' ugcaa cc ugaa g guuuguugau g uaucua ac guugauca u ||||| || |||| | |||||||||| | |||||| || |||||||| u 3' acguu gg gcuu c caaacaacua c guagau ug uagcuagu g -cuacgauuuuuguacuagcucuaagguucuucgcu uu u u u c a u gu ugu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR827 |
|
Accession | MIMAT0004243 |
Sequence |
106 - uuagaugaccaucaacaaacu - 126 |
Evidence | experimental; 454 [1-2], cloned [2], Illumina [3] |
References |
|
1 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
3 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|