Stem-loop sequence osa-MIR816

Accession

MI0005245 (change log)

Description

Oryza sativa miR816 stem-loop

Literature search

1 open access papers mention osa-MIR816
(1 sentences)

Stem-loop

                  c   a      c        a a 
5' augugacauauuuua uac acgaau uggauaug c g
   ||||||||||||||| ||| |||||| |||||||| |  
3' uacacuguguaggau aug ugcuua auuuguau g a
                  u   a      a        - g 

Deep sequencing

685 reads, 100 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

miR816 was misnamed miR576 by Luo et al [1].

Genome context

• Coordinates (MSU7): Chr10: 21808333-21808409 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0005245

Mature sequence osa-miR816

• Accession: MIMAT0004061
• Sequence: 3 - gugacauauuuuacuacaac - 22
• Deep sequencing: 27 reads, 2 experiments
• Evidence: experimental; cloned [1], Northern [1]
• Database links:
  • RNAcentral:URS0000250AC2_39947

References

1. PMID:16959252 "Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development" Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH FEBS Lett. 580:5111-5116(2006).