Stem-loop sequence osa-MIR815c

Accession

MI0005244 (change log)

Description

Oryza sativa miR815c stem-loop

Gene family

MIPF0000349; MIR815

Literature search

2 open access papers mention osa-MIR815c
(2 sentences)

Stem-loop

         -c       --      c a      cauuuagccggcuuauagcc 
5' cuucuc  ucucuuc  ucuccu c ccucag                    u
   ||||||  |||||||  |||||| | ||||||                     
3' gaaggg  agaggag  agggga g ggaguu                    a
         uu       uu      a a      ugugugggaaucuccuucau 

Deep sequencing

2457 reads, 300 reads per million, 2 experiments

Confidence

Annotation confidence: low

Feedback: Do you believe this miRNA is real?

Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context

• Coordinates (MSU7): Chr7: 5426885-5426987 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0005244

Mature sequence osa-miR815c

• Accession: MIMAT0004060
• Sequence: 80 - aaggggauugaggagauuggg - 100
• Deep sequencing: 1964 reads, 2 experiments
• Evidence: experimental; cloned [1], Northern [1]
• Database links:
  • RNAcentral:URS00001E48E8_39947

References

1. PMID:16959252 "Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development" Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH FEBS Lett. 580:5111-5116(2006).