Stem-loop sequence osa-MIR815a

Accession

MI0005242 (change log)

Description

Oryza sativa miR815a stem-loop

Gene family

MIPF0000349; MIR815

Literature search

1 open access papers mention osa-MIR815a
(1 sentences)

Stem-loop

            a   -     uu        -a     a   c 
5' uuuuuuuag cuc uuaau  cuuuuucu  ggaug acu u
   ||||||||| ||| |||||  ||||||||  ||||| ||| u
3' agagggguu gag aguua  ggaagagg  uuugu ugg a
            a   g     gg        ag     g   g 

Deep sequencing

2282 reads, 300 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context

• Coordinates (MSU7): Chr5: 29746632-29746714 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0005242

Mature sequence osa-miR815a

• Accession: MIMAT0004058
• Sequence: 59 - aaggggauugaggagauuggg - 79
• Deep sequencing: 1898 reads, 2 experiments
• Evidence: experimental; cloned [1], Northern [1]
• Database links:
  • RNAcentral:URS00001E48E8_39947

References

1. PMID:16959252 "Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development" Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH FEBS Lett. 580:5111-5116(2006).