Stem-loop sequence osa-MIR814a

Accession

MI0005239 (change log)

Description

Oryza sativa miR814a stem-loop

Gene family

MIPF0000351; MIR814

Literature search

3 open access papers mention osa-MIR814a
(8 sentences)

Stem-loop

     c   u      cga                              u 
5' ac uag accgga   gacacuucauaguacaacgaaucuggacag a
   || ||| ||||||   |||||||||||||||||||||||||||||| a
3' ug auc uggccu   cugugaaguaucauguugcuuagaccuguc g
     a   c      aua                              c 

Deep sequencing

1284 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

miR814 was misnamed miR573 by Luo et al [1].

Genome context

• Coordinates (MSU7): Chr1: 22375030-22375126 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0005239

Mature sequence osa-miR814a

• Accession: MIMAT0004055
• Sequence: 19 - cacuucauaguacaacgaaucu - 40
• Deep sequencing: 427 reads, 2 experiments
• Evidence: experimental; cloned [1], Northern [1]
• Database links:
  • RNAcentral:URS00005C1EF7_39947

References

1. PMID:16959252 "Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development" Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH FEBS Lett. 580:5111-5116(2006).