![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-742 |
||||||||||||
Accession | MI0005206 (change log) | |||||||||||
Symbol | MGI:Mir742 | |||||||||||
Description | Mus musculus miR-742 stem-loop | |||||||||||
Gene family | MIPF0000412; mir-742 | |||||||||||
Literature search |
3 open access papers mention mmu-mir-742 | |||||||||||
Stem-loop |
c - u aa g a 5' ugcu uacuca cauggu gcu ucac ug a |||| |||||| |||||| ||| |||| || g 3' auga augggu guacca cga agug au u a c c -a g g |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence mmu-miR-742-5p |
|
Accession | MIMAT0004838 |
Previous IDs | mmu-miR-742* |
Sequence |
6 - uacucacaugguugcuaauca - 26 |
Deep sequencing | 303 reads, 19 experiments |
Evidence | experimental; cloned [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-742-3p |
|
Accession | MIMAT0004237 |
Previous IDs | mmu-miR-742 |
Sequence |
41 - gaaagccaccaugcuggguaaa - 62 |
Deep sequencing | 585 reads, 24 experiments |
Evidence | experimental; cloned [1-2], 454 [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17989215
"RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
Proc Natl Acad Sci U S A. 104:18097-18102(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|