Stem-loop sequence mmu-mir-741

AccessionMI0005205 (change log)
Symbol MGI:Mir741
DescriptionMus musculus miR-741 stem-loop
Literature search

4 open access papers mention mmu-mir-741
(23 sentences)

Stem-loop
   u             u     c  a      aaau 
5'  ugaucuacguaga uggua cu ucaugu    c
    ||||||||||||| ||||| || ||||||    a
3'  auuagauguaucu accgu ga aguacg    u
   a             u     a  g      aaug 
Get sequence
Deep sequencing
168870 reads, 2.33e+03 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66796805-66796875 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-741
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
mmu-mir-463chrX: 66799223-66799297 [-]
mmu-mir-741chrX: 66796805-66796875 [-]
mmu-mir-471chrX: 66792595-66792661 [-]
mmu-mir-883bchrX: 66789890-66789967 [-]
Database links

Mature sequence mmu-miR-741-5p

Accession MIMAT0017262
Previous IDsmmu-miR-741*
Sequence

7 - 

uacguagauugguaccuaucaug

 - 29

Get sequence
Deep sequencing1588 reads, 29 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-741-3p

Accession MIMAT0004236
Previous IDsmmu-miR-741
Sequence

45 - 

ugagagaugccauucuauguaga

 - 67

Get sequence
Deep sequencing167241 reads, 43 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4-5]
Database links
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).