![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR781a |
||||||
Accession | MI0005111 (change log) | |||||
Previous IDs | ath-MIR781 | |||||
Description | Arabidopsis thaliana miR781 stem-loop | |||||
Gene family | MIPF0001137; MIR781 | |||||
Literature search |
3 open access papers mention ath-MIR781a | |||||
Stem-loop |
- uu c a a a 5' ucaaauu agaguuuucuggauacuua aguua ua c aagag g ||||||| ||||||||||||||||||| ||||| || | ||||| g 3' aguuuaa ucucaaaagaccuaugaau ucaau au g uucuu g a uu u a c c |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ath-miR781a |
|
Accession | MIMAT0003940 |
Previous IDs | ath-miR781 |
Sequence |
6 - uuagaguuuucuggauacuua - 26 |
Evidence | experimental; MPSS [1], Northern [1], 454 [2] |
References |
|
1 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|