![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR780 |
|||||
Accession | MI0005110 (change log) | ||||
Description | Arabidopsis thaliana miR780 stem-loop | ||||
Literature search |
3 open access papers mention ath-MIR780 | ||||
Stem-loop |
au u u a a ------ ----a u guuucacaaacaucaacag 5' caagau cagauauu cacgaaga aucugc uaacagcu c gagga auugugauuu auc c |||||| |||||||| |||||||| |||||| |||||||| | ||||| |||||||||| ||| 3' guuuua gucuauaa gugcuucu uggacg guugucga g uuccu uaacacuaaa uag u cg - u a c aucuuu aucac - gcagguauugcuagguacc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Fahlgren et al [2] identify two mature products from the same arm of the hairpin precursor, named here miR780.1 and miR780.2. miR780.2 corresponds to the sequence reported by Lu et al [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR780.1 |
|
Accession | MIMAT0004218 |
Sequence |
129 - ucuagcagcuguugagcaggu - 149 |
Evidence | experimental; 454 [2], cloned [2], Illumina [3] |
Mature sequence ath-miR780.2 |
|
Accession | MIMAT0003939 |
Previous IDs | ath-miR780 |
Sequence |
150 - uucuucgugaauaucuggcau - 170 |
Evidence | experimental; MPSS [1], Northern [1], 454 [2], cloned [2] |
References |
|
1 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
3 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|