Stem-loop sequence ath-MIR773a

AccessionMI0005103 (change log)
Previous IDsath-MIR773
DescriptionArabidopsis thaliana miR773 stem-loop
Gene family MIPF0001106; MIR773
Literature search

5 open access papers mention ath-MIR773a
(11 sentences)

Stem-loop 
            u    -u         au    u  aga    c 
5' aggaggcaa agcu  gagcaaaua  ugau gc   aguc a
   ||||||||| ||||  |||||||||  |||| ||   ||||  
3' uccucuguu ucga  uucguuugu  acug cg   ucag u
            u    cc         cc    u  aaa    c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 13067251-13067335 [+]
intergenic
Database links

Mature sequence ath-miR773a

Accession MIMAT0003932
Previous IDsath-miR773
Sequence

63 -  

uuugcuuccagcuuuugucuc

 - 83

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2], cloned [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).