Stem-loop ath-MIR472

Accession

MI0005102

Description

Arabidopsis thaliana ath-MIR472 precursor miRNA

Gene family

MIPF0000403; MIR482

Literature search

6 open access papers mention ath-MIR472
(10 sentences)

Sequence

ucuguauguauguAUGGUCGAAGUAGGCAAAAUCucaccuuucuagcagaucaacaaugaauuuuguggaauagauguuggauuuguaagguuuugguguuugcaaguguugagaugcgcaagauuugaguaagaUUUUUCCUACUCCGCCCAUACCauacauacacc
..(((((((((((((((.((.((((((.(((((((((((..(((.(((((((((((.(..((((....))))..))))).))))))).)))....))))....(((((.(((.......))).)))))....))))))).)))))).)).))))).))))))))))..

Structure

uc          -     U  A      C       ---------------------------------    --uu   a       -    a ga    u 
  uguauguaug uAUGG CG AGUAGG AAAAUCu                                 cacc    ucu gcagauc aaca u  auuu g
  |||||||||| ||||| || |||||| |||||||                                 ||||    ||| ||||||| |||| |  ||||  
  acauacauaC AUACC GC UCAUCC UUUUaga                                 gugg    gga uguuuag uugu a  uaag u
cc          C     C  C      U       augaguuuagaacgcguagaguugugaacguuu    uuuu   a       g    - ga    g 

Annotation confidence Not enough data

Comments

Lu et al. named this sequence MIR772 [1]. The sequence was later shown to be homologous to poplar MIR472 (MI:MI0002354), and so is renamed ath-MIR472 here [2].

Genome context

chr1: 4182132-4182299 [-]

Mature ath-miR472-3p

• Accession: MIMAT0003931
• Description: Arabidopsis thaliana ath-miR472-3p mature miRNA
• Sequence: 136 - UUUUUCCUACUCCGCCCAUACC - 157
• Evidence: experimental ; MPSS [1], Northern [1], 454 [2-3], cloned [2]

Mature ath-miR472-5p

• Accession: MIMAT0032014
• Description: Arabidopsis thaliana ath-miR472-5p mature miRNA
• Sequence: 14 - AUGGUCGAAGUAGGCAAAAUC - 34
• Evidence: experimental ; Illumina [4]

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 17299599
   High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes
   Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC
   PLoS One (2007) 2:e219


4. PubMed ID: 24119003
   Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots
   Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutiérrez RA
   BMC Genomics (2013) 14:701