![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR472 |
|||||
Accession | MI0005102 (change log) | ||||
Previous IDs | ath-MIR772 | ||||
Description | Arabidopsis thaliana miR472 stem-loop | ||||
Gene family | MIPF0000403; MIR482 | ||||
Literature search |
![]()
6 open access papers mention ath-MIR472 | ||||
Stem-loop |
uc - u a c c - -uu --a ga augaau ug ---au g ga 5' uguauguaug uaugg cg aguagg aaaaucu ac c ucu gca ucaaca uuug ga agau uug u |||||||||| ||||| || |||||| ||||||| || | ||| ||| |||||| |||| || |||| ||| 3' acauacauac auacc gc ucaucc uuuuaga ug g aga cgu aguugu gaac uu uuug aau u cc c c c u a a uuu acg ag ------ gu guggu g gu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Lu et al. named this sequence MIR772 [1]. The sequence was later shown to be homologous to poplar MIR472 (MI:MI0002354), and so is renamed ath-MIR472 here [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR472-5p |
|
Accession | MIMAT0032014 |
Sequence |
14 - auggucgaaguaggcaaaauc - 34 |
Evidence | experimental; Illumina [4] |
Mature sequence ath-miR472-3p |
|
Accession | MIMAT0003931 |
Previous IDs | ath-miR472 |
Sequence |
136 - uuuuuccuacuccgcccauacc - 157 |
Evidence | experimental; MPSS [1], Northern [1], 454 [2-3], cloned [2] |
References |
|
1 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"
BMC Genomics. 14:701(2013).
|