Stem-loop sequence ath-MIR472

Accession

MI0005102 (change log)

Previous IDs

ath-MIR772

Description

Arabidopsis thaliana miR472 stem-loop

Gene family

MIPF0000403; MIR482

Literature search

6 open access papers mention ath-MIR472
(10 sentences)

Stem-loop

   uc          -     u  a      c       c  - -uu   --a   ga      augaau    ug  ---au    g   ga 
5'   uguauguaug uaugg cg aguagg aaaaucu ac c   ucu   gca  ucaaca      uuug  ga     agau uug  u
     |||||||||| ||||| || |||||| ||||||| || |   |||   |||  ||||||      ||||  ||     |||| |||   
3'   acauacauac auacc gc ucaucc uuuuaga ug g   aga   cgu  aguugu      gaac  uu     uuug aau  u
   cc          c     c  c      u       a  a uuu   acg   ag      ------    gu  guggu    g   gu 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Lu et al. named this sequence MIR772 [1]. The sequence was later shown to be homologous to poplar MIR472 (MI:MI0002354), and so is renamed ath-MIR472 here [2].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr1: 4182132-4182299 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000019FB1E_3702
• miRBase Tracker:MI0005102

Mature sequence ath-miR472-5p

• Accession: MIMAT0032014
• Sequence: 14 - auggucgaaguaggcaaaauc - 34
• Evidence: experimental; Illumina [4]

Mature sequence ath-miR472-3p

• Accession: MIMAT0003931
• Previous IDs: ath-miR472
• Sequence: 136 - uuuuuccuacuccgcccauacc - 157
• Evidence: experimental; MPSS [1], Northern [1], 454 [2-3], cloned [2]

References

1. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2. PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4. PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).