Stem-loop sequence bta-mir-34c

AccessionMI0005068 (change log)
DescriptionBos taurus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Literature search

14 open access papers mention bta-mir-34c
(77 sentences)

Stem-loop 
        ag     a   a    a     c      c  a 
5' agucu  uuacu ggc gugu guuag ugauug ua u
   |||||  ||||| ||| |||| ||||| |||||| ||  
3' uuaga  aaugg ccg caca caauc acuaac au a
        aa     a   g    c     -      c  a
Get sequence
Deep sequencing
479 reads, 1.89 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature miR-34c sequence identified by Sonstegard et al [1] has an A base at position 11 of the mature miRNA, which conflicts with the draft genome sequence that has G as shown here.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 22282382-22282458 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-34c
bta-mir-34bchr15: 22281681-22281764 [+]
bta-mir-34cchr15: 22282382-22282458 [+]
Database links

Mature sequence bta-miR-34c

Accession MIMAT0003854
Sequence

13 -  

aggcaguguaguuagcugauug

 - 34

Get sequence
Deep sequencing474 reads, 53 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).