Stem-loop sequence bta-mir-25

AccessionMI0005067 (change log)
DescriptionBos taurus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

20 open access papers mention bta-mir-25
(55 sentences)

Stem-loop 
       a ug   ag    g     uu g     u   -  acg 
5' ggcc g  uug  aggc gagac  g gcaau gcu gg   c
   |||| |  |||  |||| |||||  | ||||| ||| ||    
3' ccgg c  gac  ucug cucug  c cguua cgg cc   u
       c gu   ag    g     uu a     -   g  ccg
Get sequence
Deep sequencing
289008 reads, 2.35e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miR-25 sequence identified by Coutinho et al [1] has an additional A base at the 5' end, which conflicts with the draft genome sequence.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 37072717-37072800 [+]
sense
ENSBTAT00000003728 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from bta-mir-25
bta-mir-106bchr25: 37072314-37072393 [+]
bta-mir-93chr25: 37072517-37072593 [+]
bta-mir-25chr25: 37072717-37072800 [+]
Database links

Mature sequence bta-miR-25

Accession MIMAT0003853
Sequence

52 -  

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing283199 reads, 76 experiments
Evidence experimental; cloned [1-2], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).