Stem-loop sequence bta-mir-23b

Accession

MI0005066 (change log)

Description

Bos taurus miR-23b stem-loop

Gene family

MIPF0000027; mir-23

Literature search

16 open access papers mention bta-mir-23b
(37 sentences)

Stem-loop

   --  --          -  c      gugacu 
5'   gg  guuccuggca ug ugauuu      u
     ||  |||||||||| || ||||||       
3'   cc  uagggaccgu ac acuaaa      a
   ca  au          u  -      auuaga 

Deep sequencing

144643 reads, 1.16e+03 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Database links

• EntrezGene:MIR23B
• RNAcentral:URS000075D7C6_9913
• miRBase Tracker:MI0005066

Mature sequence bta-miR-23b-5p

• Accession: MIMAT0012538
• Sequence: 1 - ggguuccuggcaugcugauuu - 21
• Deep sequencing: 2933 reads, 11 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:bta-miR-23b-5p

Mature sequence bta-miR-23b-3p

• Accession: MIMAT0003852
• Previous IDs: bta-miR-23b
• Sequence: 38 - aucacauugccagggauuaccac - 60
• Deep sequencing: 141707 reads, 78 experiments
• Evidence: experimental; cloned [1-2], Illumina [3]
• Predicted targets:
  • TargetScanVert:bta-miR-23b-3p

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3. PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).