Stem-loop sequence bta-let-7i

AccessionMI0005065 (change log)
DescriptionBos taurus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

53 open access papers mention bta-let-7i
(237 sentences)

Stem-loop 
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua
Get sequence
Deep sequencing
1189470 reads, 6.39e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The 5' terminal base of the mature let-7i sequence identified by Coutinho et al [1] is reported as C, which conflicts with the draft genome sequence that requires U as shown here. The 5' end reported by Gu et al. is shorter by 7 nts [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 51387456-51387539 [-]
sense
ENSBTAT00000042373 ; bta-let-7i-201; exon 1
Database links

Mature sequence bta-let-7i

Accession MIMAT0003851
Sequence

6 -  

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing1188478 reads, 76 experiments
Evidence experimental; cloned [1-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).