![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-let-7i |
|||||
Accession | MI0005065 (change log) | ||||
Description | Bos taurus let-7i stem-loop | ||||
Gene family | MIPF0000002; let-7 | ||||
Literature search |
![]()
53 open access papers mention bta-let-7i | ||||
Stem-loop |
c u u -------- u ugu 5' uggc gagguaguaguuugugc guu gg cgggu g |||| ||||||||||||||||| ||| || ||||| a 3' aucg uuccgucaucgaacgcg caa uc gcccg c - - u uagaggug - uua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The 5' terminal base of the mature let-7i sequence identified by Coutinho et al [1] is reported as C, which conflicts with the draft genome sequence that requires U as shown here. The 5' end reported by Gu et al. is shorter by 7 nts [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-let-7i |
|
Accession | MIMAT0003851 |
Sequence |
6 - ugagguaguaguuugugcuguu - 27 |
Deep sequencing | 1188478 reads, 76 experiments |
Evidence | experimental; cloned [1-3] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|