Stem-loop sequence bta-mir-30c

AccessionMI0005064 (change log)
DescriptionBos taurus miR-30c stem-loop
Gene family MIPF0000005; mir-30
Literature search

21 open access papers mention bta-mir-30c
(120 sentences)

Stem-loop 
   ca   u  -aa     cc    ugu u       u   aca        ug gag 
5'   gac gu   ccaug  guag   g guaaaca ccu   cucucagc  u   c
     ||| ||   |||||  ||||   | ||||||| |||   ||||||||  |   u
3'   cug ca   gguac  cguc   c cauuugu ggg   gagggucg  g   c
   --   -  aaa     --    uuc u       u   --a        gu gag
Get sequence
Deep sequencing
96906 reads, 1.01e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miR-30c sequence identified by Sonstegard et al [1] has an additional G base at the 3' end, which conflicts with the draft genome sequence.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 106449904-106450008 [-]
sense
ENSBTAT00000029254 ; NFYC-201; intron 5
Clustered miRNAs
< 10kb from bta-mir-30c
bta-mir-30echr3: 106453038-106453129 [-]
bta-mir-30cchr3: 106449904-106450008 [-]
Database links

Mature sequence bta-miR-30c

Accession MIMAT0003850
Sequence

26 -  

uguaaacauccuacacucucagc

 - 48

Get sequence
Deep sequencing95959 reads, 77 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).