Stem-loop sequence bta-let-7f-1

Accession

MI0005062 (change log)

Description

Bos taurus let-7f-1 stem-loop

Gene family

MIPF0000002; let-7

Literature search

59 open access papers mention bta-let-7f-1
(234 sentences)

Stem-loop

       a ug                      ---------       u 
5' ucag g  agguaguagauuguauaguugu         gggguag g
   |||| |  ||||||||||||||||||||||         ||||||| a
3' aguc c  uccguuaucuaacauaucaaua         ucccauu u
       - cu                      gaggacuug       u 

Deep sequencing

6334950 reads, 2.95e+04 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr8: 87364207-87364293 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-let-7f-1

• bta-let-7a-1: chr8: 87363854-87363933 [+]
• bta-let-7f-1: chr8: 87364207-87364293 [+]
• bta-let-7d: chr8: 87366413-87366499 [+]

Database links

• EntrezGene:MIRLET7F-1
• RNAcentral:URS00004BFD1E_9913
• miRBase Tracker:MI0005062

Mature sequence bta-let-7f

• Accession: MIMAT0003519
• Sequence: 7 - ugagguaguagauuguauaguu - 28
• Deep sequencing: 12676347 reads, 78 experiments
• Evidence: experimental; cloned [1-3]
• Predicted targets:
  • TargetScanVert:bta-let-7f

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3. PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).