Stem-loop sequence bta-mir-342

AccessionMI0005059 (change log)
DescriptionBos taurus miR-342 stem-loop
Gene family MIPF0000190; mir-342
Literature search

4 open access papers mention bta-mir-342
(7 sentences)

Stem-loop 
   uggaagc    g     c  g      --ua      gu    g   c gcaa 
5'        gggu cgagg ga gggugc    ucugug  ugag aca g    a
          |||| ||||| || ||||||    ||||||  |||| ||| |     
3'        cccg gcucc cu cccacg    agacac  acuc ugu c    u
   -------    -     u  a      cuaa      --    -   - aaag
Get sequence
Deep sequencing
34458 reads, 262 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The miR-342 mature product reported by Gu et al. is truncated at the 3' end [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 66986215-66986308 [+]
sense
ENSBTAT00000012242 ; EVL-201; intron 3
Database links

Mature sequence bta-miR-342

Accession MIMAT0003846
Sequence

61 -  

ucucacacagaaaucgcacccaucu

 - 85

Get sequence
Deep sequencing34073 reads, 76 experiments
Evidence experimental; cloned [1-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).