![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-455 |
|||||
Accession | MI0005049 (change log) | ||||
Description | Bos taurus miR-455 stem-loop | ||||
Gene family | MIPF0000129; mir-455 | ||||
Literature search |
![]()
7 open access papers mention bta-mir-455 | ||||
Stem-loop |
ucccu -g ----- u a c gaa 5' ggc ugagg guaugugccu uggacu cau gug g ||| ||||| |||||||||| |||||| ||| ||| 3' ccg acucc cauauacggg accuga gua cac c ---au ga guuca u c c gac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-455-5p |
|
Accession | MIMAT0003835 |
Previous IDs | bta-miR-455 |
Sequence |
16 - uaugugccuuuggacuacauc - 36 |
Deep sequencing | 4351 reads, 66 experiments |
Evidence | by similarity; MI0003516 |
Predicted targets |
|
Mature sequence bta-miR-455-3p |
|
Accession | MIMAT0003836 |
Previous IDs | bta-miR-455* |
Sequence |
54 - gcaguccaugggcauauacacu - 75 |
Deep sequencing | 2399 reads, 66 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|