Stem-loop sequence bta-mir-423

AccessionMI0005046 (change log)
DescriptionBos taurus miR-423 stem-loop
Gene family MIPF0000329; mir-423
Literature search

18 open access papers mention bta-mir-423
(58 sentences)

Stem-loop 
   -----auaa       u            -ag   g    a     cua 
5'          aggaagu aggcugaggggc   aga cgag cuuuu   u
            ||||||| ||||||||||||   ||| |||| |||||   u
3'          uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   cgcgcccca       u            gag   g    -     ccu
Get sequence
Deep sequencing
148685 reads, 2.18e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

High-throughput sequencing suggests that the dominant miRNA arises from the 5' arm of this precursor [3], in contrast to earlier studies.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 21923268-21923361 [+]
sense
ENSBTAT00000025760 ; NSRP1-201; intron 1
ENSBTAT00000042201 ; bta-mir-423-201; exon 1
Database links

Mature sequence bta-miR-423-5p

Accession MIMAT0012537
Sequence

17 -  

ugaggggcagagagcgagacuuu

 - 39

Get sequence
Deep sequencing79005 reads, 78 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence bta-miR-423-3p

Accession MIMAT0003831
Previous IDsbta-miR-423
Sequence

52 -  

aagcucggucugaggccccucagu

 - 75

Get sequence
Deep sequencing69680 reads, 78 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2], Illumina [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).