Stem-loop sequence bta-mir-23a

Accession

MI0005042 (change log)

Description

Bos taurus miR-23a stem-loop

Gene family

MIPF0000027; mir-23

Literature search

24 open access papers mention bta-mir-23a
(94 sentences)

Stem-loop

     c   c     -       g    g      c  c 
5' gg cgg ugggg uuccugg gaug gauuug ug c
   || ||| ||||| ||||||| |||| |||||| || u
3' cc gcc accuu agggacc uuac cuaaac ac g
     a   a     u       g    a      -  u 

Deep sequencing

139169 reads, 1.16e+03 reads per million, 78 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr7: 13046186-13046258 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-23a

• bta-mir-23a: chr7: 13046186-13046258 [-]
• bta-mir-27a: chr7: 13046007-13046084 [-]
• bta-mir-24-2: chr7: 13045858-13045929 [-]

Database links

• EntrezGene:MIR23A
• RNAcentral:URS00003C8664_9913
• miRBase Tracker:MI0005042

Mature sequence bta-miR-23a

• Accession: MIMAT0003827
• Sequence: 45 - aucacauugccagggauuucca - 66
• Deep sequencing: 138995 reads, 78 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-23a

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).