miRBase entry: bta-mir-22

Stem-loop bta-mir-22


Accession
MI0005041
Description
Bos taurus bta-mir-22 precursor miRNA
Gene family
MIPF0000053; mir-22

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Bta-mir-22 is a microRNA that has been identified as a potential regulator of tenderness and is involved in calcium signaling in the heart [PMC6182065]. It targets the mitochondrial L-carnitine shuttle pathway and glutathione reductase (GSR) [PMC6182065]. Bta-mir-22 also targets genes involved in calcium signaling, such as the calcium channel, voltage-dependent, N type, alpha 1B subunit (CACNA1B) and ATPase, calcium-transporting, plasma membrane 2 (ATP2B2) [PMC6182065]. It also targets genes from the Calpain family, including calpain 1 (CAPN1) and calpain 11 (CAPN11), as well as calpastatin (CAST) [PMC6182065]. Bta-mir-22 has been found to be differentially expressed in bovine macrophages in response to M. bovis expression [PMC4978967]. The 3p arm of bta-mir-22 precursor is functionally more relevant than the corresponding 5p arm during the late follicular phase of preovulatory stage of bovine estrous cycle [PMC4438052]. Bta-mir-22 has also been identified as miR-22* [PMC2762473].

Literature search
21 open access papers mention bta-mir-22
(70 sentences)

Sequence

968575 reads, 17980 reads per million, 78 experiments
ggcugagccgcaguAGUUCUUCAGUGGCAAGCUUUAuguccugacccagcuaAAGCUGCCAGUUGAAGAACUGuugcccucugcc
(((.(((..((((((((((((((((((((.((((((.((.........))))))))))))).))))))))))))))).))).)))

Structure
   u   cc               -     A      u  ccu 
ggc gag  gcaguAGUUCUUCAG UGGCA GCUUUA gu   g
||| |||  ||||||||||||||| ||||| |||||| ||   a
ccg cuc  cguuGUCAAGAAGUU ACCGU CGAAau cg   c
   u   -c               G     -      -  acc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 23514297-23514381 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-22
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-22-5p

Accession MIMAT0003826
Description Bos taurus bta-miR-22-5p mature miRNA
Sequence 15 - AGUUCUUCAGUGGCAAGCUUUA - 36
Evidence experimental
cloned [1], Array [2], qRT-PCR [2]

Mature bta-miR-22-3p

Accession MIMAT0012536
Description Bos taurus bta-miR-22-3p mature miRNA
Sequence 53 - AAGCUGCCAGUUGAAGAACUG - 73
Evidence experimental
cloned [3]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 19267191
    Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning
    "Long JE, Chen HX"
    "Biochem Genet (2009) 47:329-343

  3. PubMed ID: 19170227
    Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach
    "Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M"
    "Mol Reprod Dev (2009) 76:665-677