![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-210 |
|||||
Accession | MI0005039 (change log) | ||||
Description | Bos taurus miR-210 stem-loop | ||||
Gene family | MIPF0000086; mir-210 | ||||
Literature search |
![]()
10 open access papers mention bta-mir-210 | ||||
Stem-loop |
--------cc c gg a cc - c c - 5' uccagg gcag cagcc cug cac cgcaca ug g cugc |||||| |||| ||||| ||| ||| |||||| || | ||| u 3' gggucc uguc gucgg gac gug gcgugu ac c ggcc ccagcgcgac c ua c -a u c c a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-210 |
|
Accession | MIMAT0003824 |
Sequence |
54 - acugugcgugugacagcggcuga - 76 |
Deep sequencing | 10897 reads, 73 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|