Stem-loop sequence bta-mir-210

Accession

MI0005039 (change log)

Description

Bos taurus miR-210 stem-loop

Gene family

MIPF0000086; mir-210

Literature search

10 open access papers mention bta-mir-210
(19 sentences)

Stem-loop

   --------cc      c    gg     a   cc   -      c  c -     
5'           uccagg gcag  cagcc cug  cac cgcaca ug g cugc 
             |||||| ||||  ||||| |||  ||| |||||| || | ||| u
3'           gggucc uguc  gucgg gac  gug gcgugu ac c ggcc 
   ccagcgcgac      c    ua     c   -a   u      c  c a     

Deep sequencing

11342 reads, 66.2 reads per million, 74 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr29: 51369011-51369108 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR210
• RNAcentral:URS000075E38C_9913
• miRBase Tracker:MI0005039

Mature sequence bta-miR-210

• Accession: MIMAT0003824
• Sequence: 54 - acugugcgugugacagcggcuga - 76
• Deep sequencing: 10897 reads, 73 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-210

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).