![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-200a |
||||||||
Accession | MI0005037 (change log) | |||||||
Description | Bos taurus miR-200a stem-loop | |||||||
Gene family | MIPF0000019; mir-8 | |||||||
Literature search |
![]()
20 open access papers mention bta-mir-200a | |||||||
Stem-loop |
- c g - c uuuc 5' ggg c ucu uggacauc uuaccggacagug ugga ucgg ||| | ||| |||||||| ||||||||||||| |||| ||| c 3' ccc g gga acuuguag aauggucugucac aucu agcu a u a c a ---c |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bta-miR-200a |
|
Accession | MIMAT0003822 |
Sequence |
52 - uaacacugucugguaacgauguu - 74 |
Deep sequencing | 293603 reads, 78 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|