Stem-loop sequence bta-mir-199b

AccessionMI0005036 (change log)
DescriptionBos taurus miR-199b stem-loop
Gene family MIPF0000040; mir-199
Literature search

13 open access papers mention bta-mir-199b
(32 sentences)

Stem-loop 
   ----------cc    cu  -     c       u       u    u  ----  a 
5'             ucca  cc gucua ccagugu uagacua cugu ca    gg c
               ||||  || ||||| ||||||| ||||||| |||| ||    ||  
3'             gggu  gg cggau gguuaca gucugau gaca gu    cc u
   ggcucccagauu    cg  u     u       c       -    u  uaaa  c
Get sequence
Deep sequencing
424604 reads, 3.42e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 99127762-99127861 [-]
antisense
ENSBTAT00000032743 ; DNM1-201; intron 15
Clustered miRNAs
< 10kb from bta-mir-199b
bta-mir-3154chr11: 99127964-99128048 [-]
bta-mir-3604-2chr11: 99127781-99127853 [+]
bta-mir-199bchr11: 99127762-99127861 [-]
Database links

Mature sequence bta-miR-199b

Accession MIMAT0003821
Sequence

16 -  

cccaguguuuagacuaucuguuc

 - 38

Get sequence
Deep sequencing58145 reads, 63 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).