Stem-loop sequence bta-mir-191

AccessionMI0005034 (change log)
DescriptionBos taurus miR-191 stem-loop
Gene family MIPF0000194; mir-191
Literature search

21 open access papers mention bta-mir-191
(57 sentences)

Stem-loop 
   -   u   c      c          c  aa       uu  -  c 
5'  ggc gga agcggg aacggaaucc aa  gcagcug  gu cu c
    ||| ||| |||||| |||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc uugcuuuagg uu  cgucgac  ua ga a
   u   u   c      c          -  cg       cu  c  g
Get sequence
Deep sequencing
1139271 reads, 1.46e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 51727524-51727614 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-191
bta-mir-191chr22: 51727524-51727614 [+]
bta-mir-191bchr22: 51727536-51727599 [-]
bta-mir-425chr22: 51728006-51728092 [+]
Database links

Mature sequence bta-miR-191

Accession MIMAT0003819
Sequence

15 -  

caacggaaucccaaaagcagcug

 - 37

Get sequence
Deep sequencing1137422 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).