![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-191 |
||||||||
Accession | MI0005034 (change log) | |||||||
Description | Bos taurus miR-191 stem-loop | |||||||
Gene family | MIPF0000194; mir-191 | |||||||
Literature search |
![]()
21 open access papers mention bta-mir-191 | |||||||
Stem-loop |
- u c c c aa uu - c 5' ggc gga agcggg aacggaaucc aa gcagcug gu cu c ||| ||| |||||| |||||||||| || ||||||| || || 3' ccg ccu ucgucc uugcuuuagg uu cgucgac ua ga a u u c c - cg cu c g |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bta-miR-191 |
|
Accession | MIMAT0003819 |
Sequence |
15 - caacggaaucccaaaagcagcug - 37 |
Deep sequencing | 1137422 reads, 78 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|