![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-17 |
||||||||||||||
Accession | MI0005031 (change log) | |||||||||||||
Description | Bos taurus miR-17 stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
![]()
31 open access papers mention bta-mir-17 | |||||||||||||
Stem-loop |
ga -ca a g g - au 5' guca auaaugu aagugcuu ca ugcag uag ug a |||| ||||||| |||||||| || ||||| ||| || u 3' cagu uauuacg uucacgga gu acguc auc ac g gg aug a g - u gu |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence bta-miR-17-5p |
|
Accession | MIMAT0003815 |
Sequence |
14 - caaagugcuuacagugcagguagu - 37 |
Deep sequencing | 13481 reads, 71 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
Mature sequence bta-miR-17-3p |
|
Accession | MIMAT0003816 |
Sequence |
51 - acugcagugaaggcacuugu - 70 |
Deep sequencing | 3561 reads, 74 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|