![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-132 |
||||||
Accession | MI0005028 (change log) | |||||
Description | Bos taurus miR-132 stem-loop | |||||
Gene family | MIPF0000065; mir-132 | |||||
Literature search |
![]()
15 open access papers mention bta-mir-132 | |||||
Stem-loop |
c cccc - c a a uuc -g 5' cgc gcgu cu c gggc accguggcu gauuguuacu uggg ||| |||| || | |||| ||||||||| |||||||||| ||| a 3' gcg cgca ga g cccg ugguaccga cugacaaugg gcca c cacc c c c c cau ag |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence bta-miR-132 |
|
Accession | MIMAT0003812 |
Sequence |
59 - uaacagucuacagccauggucg - 80 |
Deep sequencing | 4648 reads, 67 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|