Stem-loop sequence bta-let-7d

AccessionMI0005026 (change log)
DescriptionBos taurus let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

55 open access papers mention bta-let-7d
(212 sentences)

Stem-loop 
          a              c      u  -------      g 
5' ccuagga gagguaguagguug auaguu uc       gggcag g
   ||||||| |||||||||||||| |||||| ||       |||||| a
3' ggauucu uuccgucguccagc uaucaa gg       cccguu u
          -              a      u  aggaaca      u
Get sequence
Deep sequencing
118594 reads, 542 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 87366413-87366499 [+]
intergenic
Clustered miRNAs
< 10kb from bta-let-7d
bta-let-7a-1chr8: 87363854-87363933 [+]
bta-let-7f-1chr8: 87364207-87364293 [+]
bta-let-7dchr8: 87366413-87366499 [+]
Database links

Mature sequence bta-let-7d

Accession MIMAT0003810
Sequence

8 -  

agagguaguagguugcauaguu

 - 29

Get sequence
Deep sequencing110249 reads, 76 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).