![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-15b |
||||||
Accession | MI0005012 (change log) | |||||
Description | Bos taurus miR-15b stem-loop | |||||
Gene family | MIPF0000006; mir-15 | |||||
Literature search |
![]()
20 open access papers mention bta-mir-15b | |||||
Stem-loop |
u --a gua u c c ua a ac 5' ugag ccuuaaa cug agcagca au augguu cau cu a |||| ||||||| ||| ||||||| || |||||| ||| || g 3' acuu ggaauuu gau ucgucgu ua uacuaa gua ga u u aaa aaa c u u gc - ac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-15b |
|
Accession | MIMAT0003792 |
Sequence |
20 - uagcagcacaucaugguuuaca - 41 |
Deep sequencing | 19734 reads, 74 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|