Stem-loop sequence bta-mir-107

Accession

MI0005006 (change log)

Description

Bos taurus miR-107 stem-loop

Gene family

MIPF0000024; mir-103

Literature search

12 open access papers mention bta-mir-107
(23 sentences)

Stem-loop

   c   c      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  aga acgaaa   ucgg ga auguuacgacg aac uug g
   -   c      cua    -  c           -   -   a 

Deep sequencing

222103 reads, 1.51e+03 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr26: 11348565-11348645 [-]
• Overlapping transcripts:

  sense

  ENSBTAT00000042222 ; bta-mir-107-201; exon 1

  ENSBTAT00000050296 ; PANK1-201; intron 5

Database links

• EntrezGene:MIR107
• RNAcentral:URS000008F0CF_9913
• miRBase Tracker:MI0005006

Mature sequence bta-miR-107

• Accession: MIMAT0003785
• Sequence: 50 - agcagcauuguacagggcuauc - 71
• Deep sequencing: 222058 reads, 78 experiments
• Evidence: experimental; cloned [1]
• Predicted targets:
  • TargetScanVert:bta-miR-107

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).