![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-107 |
|||||
Accession | MI0005006 (change log) | ||||
Description | Bos taurus miR-107 stem-loop | ||||
Gene family | MIPF0000024; mir-103 | ||||
Literature search |
![]()
12 open access papers mention bta-mir-107 | ||||
Stem-loop |
c c --c u u c u a 5' ucu ugcuuu agcu cu uacaguguugc uug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g 3' aga acgaaa ucgg ga auguuacgacg aac uug g - c cua - c - - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-107 |
|
Accession | MIMAT0003785 |
Sequence |
50 - agcagcauuguacagggcuauc - 71 |
Deep sequencing | 222058 reads, 78 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|